[Back to Top Page]

AyFb_a022-1 Inverse PCR sequence

>AyFb_a022-1 L
TTAAGTAACTAGATTTTCTGGGGTCTGAGCTATCGAGAGCAAACCAACATACTAAAAACG
TATCCTACTTCGGGTTTT

>AyFb_a022-1 R
TTAAAGATCTTTTTGTGAAAAAGTTTGGATTGCTTAAATATTTTCATAATATTATCTTGA
TCACAGATCTGCACGCAGCCCTACAGTTACAAGCACGATTTTAATCGGCACTGCTTTAAA
AAGCACGGTGTCTTTTTAAAGCGGAGGCCAGTCTACGTCATGAACGAGGAAGTTTTGGCC
CAAGAACGGATCATTATGAAAGACCTACTATTAAGGATCCAAGGAATCATCAAAGAC