[Back to Top Page]

AyFb_a034 Inverse PCR sequence

>AyFb_a034 R
TTAATATTGAATTGTCATCGGTCCTTATTAAGCATACCAAATTTCGAGTTAACCCAACGT
TTTGAATGGGGT