[Back to Top Page]

AyFb_a034-1 Inverse PCR sequence

>AyFb_a034-1 L
TTAAAAAAGATTTGCGCTTTACTCGACCTAAACTTTAAACACGTCATAGAATCTTCGTTT
GACAAAAACCACATTGTGGCCAAGCTGTGTGACGCGACGCGCGCTAAAGAATGGCAAACC
AAGTCGCGCGAGCGTCGACTCTAGCTAGAGGATCAATTCGTAATCATG