[Back to Top Page]

AyFb_a035-1 Inverse PCR sequence

>AyFb_a035-1 L
TTAAGTAACAAATAAAAGCCAAGTGAGCTGAGACTTTAATAGCCTAAAAACATCTTTATT
TATTTATCATTTTCCAATT

>AyFb_a035-1 R
TTAAACCCTGCACCTATTATTTAAATTACCCGTACGCTTGTTTTCGTTACTTATATATTA
CTTTGCTGTGTTGGATGTTCAAT