[Back to Top Page]

AyFb_a038 Inverse PCR sequence

>AyFb_a038 L
TTAAAACAGTTTAAAGTTGGAGCACTTCTCACTGCATCCGGCAGAGCATTCCACAATCGA
ACCGCATGGACGGTGAATGA

>AyFb_a038 R
TTAAAAGAATGGTGAAGGAACACCNCTTATCTGCTTAGTGCTGTTTGTTTGCATCATTTC
CATACTGTTGATTTATTATGTGT