[Back to Top Page]

AyFb_a059 Inverse PCR sequence

>AyFb_a059 L
TTAAAATGTTAACAAAAAAATACTGCAACCTAATCATGATATTATCTTAGGATATTTTAT
AATACCTGACAAATATTCA

>AyFb_a059 R
TTAAATGCGGACGGATTATCCGGTTATGAGAGCTGGAACCGACCTGATAATGAGAA