[Back to Top Page]

AyFb_a070-1 Inverse PCR sequence

>AyFb_a070-1 L
TTAATATTCTGAGAACGTAGGTCTCTAGGTGATATGAAGTCAGTCTAGCATACATCTTTA
AAATTGTGGACAAATCTTA

>AyFb_a070-1 R
TTAAAAAAGAAACGAAATAACAGTTGATCTCAAAATAATCTAAATCAGTGATTACCTGTT
ATTTCACATCTTCGATATTAGTT