[Back to Top Page]

AyFb_a078 Inverse PCR sequence

>AyFb_a078 L
TTAAGGTGTTTTTAGAAGCACTTGTAAAAAAACCTTTTTTTTTATTGCCAGATCAGGCAG
ACGAGCATACGGCCCACCTG

>AyFb_a078 R
TTAAATAAGTTCATGCCTCACTTGCCCCGAGATGGCTCACTGGCGTTACTTGCATCTGTT
ATGAAGATACTCATCTCTTTTATCGTA