[Back to Top Page]

AyFb_a097 Inverse PCR sequence

>AyFb_a097 L
TTAATAAATAATTCATAATAGGAGTATATTGTGGGTTCCGG

>AyFb_a097 R
TTAATGTACCTTACGTTTGTTAAGCTTTACGAAAAGTTTGATGAGCTTAGCGTTTTTCAC
CAACATAATGTCTTTGTGAATAATAT