[Back to Top Page]

AyFb_a101 Inverse PCR sequence

>AyFb_a101 R
TTAAAAAAGAAACGAAATAACAGTTGATCTCAAAATAATCTAAATCAGTGATTACCTGTT
ATTTCACATCTTCGATATTAGTTAATA