[Back to Top Page]

AyFb_a104 Inverse PCR sequence

>AyFb_a104 L
TTAAAAAAGCTTTCGGGATTACTTAAGAAGTTAAAGAAAGAAATTGAGTTGAATTAATTA
TTGACGCTTTGTTTTA

>AyFb_a104 R
TTAAGTAGAAAACAATACTAAGTGCCAAGTTACTTTGGACGGCCTAGCTTTTTGTATGGA
TCTCGNGTGATTTTTGAACTTTTTCGT