[Back to Top Page]

AyFb_a119-1 Inverse PCR sequence

>AyFb_a119-1 L
TTAAAATATTGGACGTTACTCGTTGTTAACGCTCGCGCTGGCCTGTAACAAGTATACCTC
GCGCATGCGTTCGAG

>AyFb_a119-1 R
TTAAAGAAGTATTTAAATATTTCTACATTCTATATTTTAAAAAATATATAGTATAATGTT
GAAGATGTCGCATCTCTTATACAC