[Back to Top Page]

AyFb_a123-1 Inverse PCR sequence

>AyFb_a123-1 L
TTAATTTAGTTTTAAAGATTGTTACAAGGAAAACTTCTTTTCTTTCCCATTAGATCAAAC
ATTACTACTGTGCATTATTG

>AyFb_a123-1 R
TTAAGTATAGCTCCCGAGCTAAGGTCCCCGGGCTTTACATAATTTTACCTTCTGCTATCG
TTAACGCTTGTAGTAAAGTACATAAAATAGACCACGAATAGCCCGGGGAGTAGCGGCTTT
TTTAGTGAAAACTCCTTAGCATCGTTGTAATTCGAAAGTTGATGAAATGAAAAAGCGATA
GTAAAAAGAGACAGACAAATTCGTATGATTTAACGTGACAGAAAATTAGATAGGAAGCAA
TACAGTGCTTTTTAT