[Back to Top Page]

BmA3_0070 Inverse PCR sequence

>BmA3_0070  L
TTAATTACCTACCCTTTGAAATAAACAGTAGTTGACTGTCGTAGAAGGCCGTGATAAACT
TAAAGACTTGTTAATGTAATTAAAAATCACTTAGCAGTGACCATTACCAACAGGTTACAG
CAGTATACGGCTGACATTTCGCAACCAACAGCACTA