[Back to Top Page]

BmA3_a028 Inverse PCR sequence

>BmA3_a028  L
TTAAATAAAGGTTAATACTTAACCTGTTATATGTCTAAGATGTCGTTCCGAAGAGTTTTG
TGACTGCCAATGGAATACAAAGTCAATAATTCGTTTTTCTGATTTACCAATCATTGTCCA
AAAGTCAGATTGCCGGCTTTGATAATAGTCGACTCATATACAGTACCAGGCGATAAATAT
TGCACATGGATATTTAGACAAAGACAGTCGTCTAATTTTGGTTTTGTAGAGCGCTATCTC
TATGTGACGAAACAACTATCTAATATCTATGGGGACCAAATGTCAATTAGGTAATGTGCG
ATAGAGATAACGCTCTACAAAACAAAAATTAGCCGACTGTCTCTTTCCCACGGTCGATGT
ACAATATTTATCGCCGGGTACTTTACATACATGTTTCAGGAGAGTTCCTATGTAGCAATA
CTTAATGGGTGGTGAATATTTAAAGCAAGTAAAACCTCTACAAATGTGGTATGGCTGATT
ATGATCTAGAGTCGCGGCCGCTACAGGAACAGGTGGTGGCGGCCCTCGGTGCGCTCGTAC
TGCTCCACGATGGTGTAGTCCTCGTTGTGGGAGGTGATGTCCAGCTTGGCGTCCACGTAG
TAGTAGCCGGGCAGCTGCACGGGCTTCTTGGCCATGTAGATGGACTTGAACTCCACCAGG
TAGTGGCCGCCGTCCTTCAGCTTCAGGGCCTTGTGGGTCTCGCCCTTCAGCACGCCGTCG
CGGGGGTACAGGCGCTCGGTGGAGGCCCTCCCAGCCCATGGTCTTCTTCTGCATCACGGG
GGCCGTCGGAGGGGAAGTTCACGCCCGATGAACTTCACCTTGTAGATGAAAGCAGCCCGT
CCTGCACGGGAGGGAGTCCCTGGGTCACGGGTCGCCACGCCCGCCCGTTCCTCCGAAAGT
TTCAATCACGGCGCTCCCCCACCTATAAAA

>BmA3_a028  R
TTAATGCAGGTTTTGAACCGTATTCTTTGAAGGAGACGATTATATTCAAATCAATCTGTA
TTGTCATATCAATAAATTTTTTTTGTCCAAATGCACAGATTGCCACCTTTGATAATAGAC
GACTTATATATTGCATAACAAAGTTAGTAGATGCCAAAGTCAGGCGTCTTACCTTAAACT
AAATAATTAGTACCTCTATGGGTTGAAGCTTTGATAAAATCCGTTTATACCACTATTTAA
TCATCAATCGAGTTATGTTATATAATAATTTTGTTTAGTCTGCCATTGGATCAAACAAAC
GCGAGATACCGGAAGTACTGAAAAACAGTCGCTCCAGGCCAGTGGGAACATCGATGTTTT
GTTTTGACGGACCCCTTACTCTCGTCTCATATAAACCGAAGCCAGCTAAGATGGTATACT
TATTATCATCTTGTGATGAGGATGCTTCTATCAACGAAAGTACCGGTAAACCGCAAATGG
TTATGTATTATAATCAAACTAAAGGCGGAGTGGACACGCTAGACCAAATGTGTTCTGTGA
TGACCTGCAGTAGGAAGACGAATAGGTGGCCA