[Back to Top Page]

BmA3_a100 Inverse PCR sequence

>BmA3_a100  L
TTAAAGCTTGACTATCACCTAATAGGAAATCATTATAATTATTTGCATTTTTTATTTTAT
TTTTTATTGCTTAGATGGTTGGACGAGCTCACAGCCCACCTGATGTTAAGTGGTT