[Back to Top Page]

BmA3_a110 Inverse PCR sequence

>BmA3_a110  L
TTAAGCAAAACACTATATCAAGATAGACACAAGACTTAGAGACAATCATTTTAATCCAGT
TTCAATCAGATTTGGACAGCGTCAAAGAGGATTTATAGCTGTGCGCCCGAGAGGTAACCA
CCCGGTGCTCCGGGATTACAATATTTATGTCCCGTCGCAGACAACGTAAACTGATTTACG
TCACATTC