[Back to Top Page]

BmA3_a183 Inverse PCR sequence

>BmA3_a183  L
TTAAGCGTCCACTCCATATTTAAAAATGAATGAAAATTCTAAAAGTATACATTTTTATTT
TCATGAACAATTCGAAATTCGAATTCAATAAACTTTTTTGTGGCC