[Back to Top Page]

BmA3_a184 Inverse PCR sequence

>BmA3_a184  L
TTATTGACATTAATTTACCTTACTTTGTTTAAATATCAATAGTAGTAGTTTTATTTTTCC
AGCTGGAAAGGCAAAGGTATC