[Back to Top Page]

BmA3_a233 Inverse PCR sequence

>BmA3_a233  L
TTAACACTGTAGCGGTGACAGTTATACCCTTGACGTTTAGATGGCGTTTGTGGATAGACC
AGTTTATGGAGTAAGATAAAAGATTTAGCGTTTTTATAAAAAAAATTTTTTTTTTTTTTT
AA