[Back to Top Page]

BmA3_a234 Inverse PCR sequence

>BmA3_a234  L
TTAATATTAATACGTGCGAATCCTGAGCGTTCGTTTAGGTTATATTATTTAGGTATGAAC
AGCAAACTTTCACTATGATCACAAAGTCAATTGCTCGGACCCATTGTAAAAGG