[Back to Top Page]

BmA3_a234-4 Inverse PCR sequence

>BmA3_a234-4  R
TTAAACAAGAGAATTCGACATTGTTTATTAATTAATAAGGTTGGTTGATTAGAAGATTAG
GTTAGAT