[Back to Top Page]

BmA3_a293-1 Inverse PCR sequence

>BmA3_a293-1  R
TTAATAATAAACTTAGCAGGTATAGGTACTGCTTTTTTATTGTTCATATTGTTGACAAAC
TCACTTATTGTTAAATGGTTA