[Back to Top Page]

BmA3_original_193-2 Inverse PCR sequence

>BmA3_original_193-2  L
TTAAGAAGGACATCACAAGTTATTATTGGATTCTGATTAATTCAAAGCCTGTAGCCTGGT
ATAAAATAATTAAATGTATAACGTATTTCCCCATACGACTCTGGAAATCATATATTTAGA
TAATTACCCATCTTCGTTATTGTCTTTACTGCATTTTGTCGTAACAGCTGTACGGTATGA
GACGATATAAATCAATTTAGATTTTATGGTCGTTATGTCATACCTACTCAATCAATAGAA
AGTTTTAGAAAACTAACGGTAAAATCACAAGGTCACAACAACTCGTACTACAGAACACGC
TCTCAGAAGTTAACCAATTGAATGAAGTTTTTTATGATCAACATTTTTAAATTGATTTAA
TTTTTTTTTGTTTCTTTACAATCTTGGGCTGTTACTGTATAGATCTTCATCAGAATTATA
CTAATGTAAGCAAAAGGTAACTATGAAGTATATGCTATATTTAAGCTCATTTAAGATTGT
CAACTCACATTACTAAACCATCATATTATCCTTCCAGAGATGGTTGATTGATAAACATGG
ATGTTTTTTTCCAAATCTCAAAAGAATGTGTACGCGTAACAATAGTAGTAGAGTTCAGTT
GCTCCGATTTTAAAGTTTTACTCAAAAAACCGGTTCTCACATTCTATTGAACTTTACTAG
GTTGTACCGTGATTCAATCCGCTTTGAATTTAGAAAAAAGTATATATTGGGAAATGTTTG
ATATGACATGTTTTTATGTTCGGTGCGAGAAATATAACAATAGTTTTTTCGGGTGCTAAC
AGGTGCTATAGATATGTAACCTTGACCTACCGAAACTGCTGCTTTCAACTCCCCATCACC
GGTCCATAATAGTACATCCCTCACTTTATTTTCCTACTATTTCCTAGATATATTTTAGCG
GTTGTAAGGAGTATTGTCAGCTCACATGGCTAAGCTCCACCGCTCTTTCTACCGTGAATC
TGTCGTGCGTTCAGACTTGAAGCTTGGATCCTAATTGAATTAGCTCTAATTGAATTAGTC
TCTAATTGAATTAGATCCCCGGGCGAGCTCGAATTAGATCTGACAATGTTCAGTGCAGAG
ACTCGGCTACGCCTCGTGGACTTTGAAGTTGACCAACAATGTTTATTCTTACCTCTAATA
GTCCTCTGTGGCAAGGTCAAGATTCTGTTAGAAGCCAATGAAGAACCTGGTTGTTCAATA
ACATTTTGTTCGTCTAATATTTCACTACCGCTTGACGTTGGCTGCACTTCATGTACCTCA
TCTATAAACGCTTCTTCTGTATCGCTCTGGACGTCATCTTCACTACGGTCGA

>BmA3_original_193-2  R
TTAAATAGGTGACATCATAGAGCAGATTGTGCCGTCATAATTACTTAAGTACTCTCAAGG
TTGTACATGTAACAGACCATTTAATTCATTGAATAGGAAAGTTTCGACACGACGCTGTAC
GAATTTTACGATAAAATATGGTTAGTTTGTTTTAGATGTGATAACAATTCAGTTTACGAT
TGGCGTGTTACAGCAGAGCATAGCACTTTGAACGTTCAAATGATATGCTCGAGTCTGCAA
TAATATTTCCTGGGTGCACGCTATTTAAATCTTCCTCTGCATGTTACATGCTTATTAAAA
TAATTTATAAAGACATGAATATGTTTAGTGAAAATTATTAATGTCGATACTGGAATATCA
GTTATGTATTCCGTCATGCGGTGACTAACATCACAAATAAAATAATAGAGTCTTCATTAA
TTGAAGAAACACTGTTATGTCATCATCAATGAAACAATCAACAGAAAAAACATTAAACGA
ACGTGTGAATGCCTGTTGAATTCAACTTGTTGATTTAAAGAATCAACATTGGTAGCTGTC
GTAAAAGATAAATTATGTTTTATGTTTCTTAATTATTGAAAGAAATATTAATCAATATTA
CGTTATTATAATGTAAACGATAGCTTTGGTTGACACAATATATTTAAAACCACTGATTAA
CGTCCTTGACATACAACCTGAACTGCTGAATTGTGGATTTGAAAATATTACATACACGTA
AAATTTGTTTAGCAAACAATCCGATAGCGTCCGCAGCTGCATCCGTCTCAACGGCCACTT
TCTGTACGAATTTAAATGTAGTTTTCACGTTATAATTTTTTTATTATTTTCTGATC