[Back to Top Page]

GT02-0012 Inverse PCR sequence

>GT02-0012 L
GTCGAATGCGTAAGCTTTGAAACTGCATTCGATTTCATAATGAACTCCATCACAAAGTAC
ATCGTTCTAGTTGATCAGGCTTGAATACAAGCTGAGCTACAGGCAATGGGTAAGTGTTAC
TGAGCCAAGACATTACACGTATGCGCCACCACCTGAGATATAAGTTCTAGATCTCAGTAA
GTACACGCTACCCCACCTCAAACGAACGCATACTGCTCACGCAGAAATAGACGGGCTGTG
TACTACCCGTGCAGAAACACAAGTGGTCCTACCACCAGTAATTACGCAAATTATAATTTT
ACGGGTTTGATTTTTATTACACGATGTTATTCCTTCACTGTGGAAGTCAATCGTGAACAT
TTGTTGACTACGTATTTCATTAGAAAAAATTGTACCTGCCTGGGACTCAAACACCGGTGC
ATTGCTTCAACACGAATGCACCGGACGTCTTATCCTTTAGGCCACGACAACTTCATTCTT
TAATTTATGTAGATTTTTTATTTATAACCACAACCAAAGATTTATATATAACCACACAAT
ATTTCTAAAACTCCGCAGTCAGCTTTCTTTGATGGAAAACAACCAAACTGGCATCATGAA
GATTGTTTGTTTAAAAAGCGACGTTTAAACAGTTTCACTGAAATTGCAAACTTCAATGTA
CTTAACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATT
GACGCATGTGTTTTATCGGTCTGTATATCGAGGTTTATTTATTAATTTGAATAGATATTA
AGTTTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGT
TTATTTATTTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACTT
TTATGGCGCGCCGTGAGCTCATCGATTCTGGACTATGCACTTCGCCTCTCGGCCGGTGGG
CCGTTATCGACCGTTATCTGACGAATGACTTTGTTCTGTTTCAGgtcgaattgatgtgat
ggatccaATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTAAAAAG
CTCAAGTCTCCAAA

>GT02-0012 5-RACE
GACACTGACATGGTTGGAAAGAGCAGAGAACTTTATGAGCATTTGTTTGAACGTTGTAAA
CCATGGATTATACACTTAATATATTCGAGATGTTGTAAACTGTATGTAGCAAAAAGAACT
ACCTTAGTTTCATAAAAAGTACATTAAAGGTAATACATAACAGAATTGCAAAAAAATGGC
TGACTTGCCTTATCAAGTTGAATACGCAAAGACAGGTAGAGCAGCCTGTAAGGGTTGTAA
ACAAAAAATTGATCAAGGCTCACTGCGCATTGCTGTGATGGTACAGgtcgaattgatgtg
atggatccaATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTTAAA
AAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAACAACTGGGAG
TTCGCTACTCTCCCAAAGCA