[Back to Top Page]

GT02-0013 Inverse PCR sequence

>GT02-0013 L
ACTTATAGAGAATATAGAGAAGAAGTGCACAATGCTAATATTTTTTTTAAATAATGCATA
AAAGATACATTAAATCAATAAAGGAAACATTACACACACTACATACCATGTATTTGACGC
ACACACGCATGCATACTATTTATTGTCAAACTTTTGTTGTTGGCGTCTGTTGTCAAATTG
AGAATAGATTAAATATTGTTTGCCTTTGTTAATATTTTTTATAGTGTAGTCTTGGCGAAA
TTAGTGATTATAGAAGTATAAAATACAATCATAATAGTGTACAAACTTACAATTCCAATT
AACCCTAGAAAGATAATCATATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGAC
GCATGTGTTTTATCGGTCTGTATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGT
TTTATTATATTTACACTTACATACTAATAATAAATTCAACAAACAATTTATTTATGTTTA
TTTATTTATTAAAAAAAAACAAAAACTCAAAATTTCTTCTATAAAGTAACAAAACTTTTA
TGGCGCGCCGTGAGCTCATCGATTCTGGACTATGCACTTCGCCTCTCGGCCGGTGGGCCG
TTATCGACCGTTATCTGACGAATGACTTTGTTCTGTTTCAGgtcgaattgatgtgatgga
tccaATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTGCCGACTAAAAAGCTC
AAGTTCCAAG

>GT02-0013 5-RACE
GGACTTGGCCCTGGCATGGAGGGAAGGAAAAAAAAATTCTGTGGAGCCGCTAAAGTCGCG
AGTGCATGTGAAGTTCTGTTTGTGGAAAAAAAATTTGATAGGTCTAAATTTCGGATGTCT
TGTTACGAAAATAGATAGCGAAAATGGTACTGATAGTGCGGTAAAATAGTAAAAACTTCA
TAGAAAGACTTGAGTCCCTGTTTTTATTTCGTGCCAAGTGTCAGTATTTAGTGAGGATTA
TGAACTTTGAGGACTATGAAACCCTTCCGACCCAAAACTTCGTCACGCACATGACTGCCG
GGGCGATAGCGGGTGTTATGGAGCATTGCATAATGTACCCGCTGGACTCCGTTAAGgtcg
aattgatgtgatggatccaATGAAGCTACTGTCTTCTATCGAACAAGCATGCGATATTTG
CCGACTTAAAAAGCTCAAGTGCTCCAAAGAAAAACCGAAGTGCGCCAAGTGTCTGAAGAA
CAACTGGGAGTTCGCTACTCTCCCAAGCA