[Back to Top Page]

GT02-0020 Inverse PCR sequence

>GT02-0020 L
GGCGCACGATTTTTTAAGGGTACCTCTGTGGACCAAACCGGGTCCCTCTAGTGGGTACCA
CAACAGGTCCCACCATGCGTACCAACTACAGGTCCCACCATTAACGCCCCCGCAACTGGT
GTAAGGAGTCCAACACTCATATAAATATTAGCCTATCCATTAAGTACATATATTTTCTAC
ATGGATACCAAGTTTCAAGTCAATCGGATGCATGGTTCAGTAGTTATAACGGAACATCCG
TAAAAACCACTATAGATTTATATATTAGTATAAATAGACGAACACAAAAATATTATTTCA
TGAAAGAGCATAAGCTTAGATATCATTCGACGTTACGACGTGTCGAGTTTTAATACTCAA
TGTATTCGACAAACGTTTATAGAACAACCGAATCTATATTAACCCTAGAAAGATAATCAT
ATTGTGACGTACGTTAAAGATAATCATGCGTAAAATTGACGCATGTGTTTTATCGGTCTG
TATATCGAGGTTTATTTATTAATTTGAATAGATATTAAGTTTTATTATATTTACACTTAC
ATACTAATAATAAATTCAACAAACAATTTATTTATGTTTATTTATTTATTAAAAAAAAAC
AAAAACTCAAAATTTCTTCTATAAAGTAACAAAACTTTTATGGCGCGCCGTGAGCTCATC
GATTCTGGACTATGCACTTCGCCTCTCGGCCGGTGGGCCGTTATCGACCGTTATCTGACG
AATGACTTTGTTCTGTTTCAGGTCGAATTGATGTGTGATCCAATGAAGCTACTGTCTTCT
ATCGAACAAGCATGCGATATTTGCCGACTAAAAAGCTCAAGCTCCACGTCT