KAIKObase gene description page [BMgn009999/Gene03710]

Outline

Official gene ID BMgn009999
Local gene ID Gene03710
Chromosome chr7
Start (Chr.) 57125
End (Chr.) 61989
Scaffold Bm_scaf170
Start (Scaf.) 57125
End (Scaf.) 61989
Direction +

Member sequences

ID Type Representative
AK385243 full-length cDNA Yes
BGIBMGA009999 predicted gene No

Representative sequence

Nucleotide

 TGGGACAGTTTGTGTTTTCCAATATAATTTATTGTATGATAACAAAAGTATAGATATAAATTAGAAACGAAAAGTCAACGTATTGTCTTTAAACTGTAAAAAGGGATGCTTAAATAAAATATGGCTTTATACGAAGGGATAGCTCTAATACAAGAGAAACAAGCCGTTGTACTAGATTTGGGCAGTGAATATACCAAGTTTGGTTTTACTGGTGAAGCAGCTCCACGATGTATTATAAGATCACAATTCTGGTGCTCGACAGAAAGAAGATTCAAGAAGGTTTATGAGTACTCTACACCTGAGGAGCTATATGATAACCTAGTTAATATGTTACATTTATTGTATTTTAGGCATGTCCTGGTGAATCCAAAGGAACGTAAAGTGGTTGTAGTGGAGTCCCTGCTCACTCCTACTCTGTTCAGGGAAACACTAGCCAAAGTACTGTTCACACATTATGAGGTGTCTGGCGCGGTGTGGGCGGACAGTCCGCGGATGTGCGCGATGACGCTGGGCGCGCCTGTCACGCTGGTGGTGTCTCTGGGCGCCCGGGAGGCCGAGGTGGCCGCCGTGGTGCACTCGTGCGTGGTGCTGCGCGCCGTGCAGGCGCAGCCGCTGGGCGCCGCCGCCGTGCGCGCCGAGCTGCTGCACCTCCTGCGCCAGGACTGCGGCCCCGACCTGCACCTACCCGACCATGTGCTCGAGGACATCACAGTGAAGACGTGCTTCGTGAGCCCGCGGGCGCGCGCGCTGCGCTGGCAGTCGGACAGCCCGCCGGAGCCGGCGCGCAGCGTGCGCTACCCGCTGGCGCGGCTCGGCGCCGTGTGCGTGTCGGGGCGCGCGCGGGAGCTGGCCGCCGAGCCGCTGTTCCGGCGCGACAACGAGCTGGCCTCTCTCCCCGACATCGTGCTGCAGTGCATCATGCAGTGTCCGATCGACGTGCGGCGCGCGCTGGCGGCCAACGTGCTGCTGACGGGCGGCGCGGCGTCGCTGCCAGGGCTGCGCGCTCGCCTGTCCCAGGAGTTGGCGCACCTGTGCACGCTGCCGCCGTACAGCTCGCGGCTGCGGCTGGGCGAGTTCAAGTTCCACCGAGCGCCGGCGCACGACATGAGCTGCGCGTGGCTGGGCGGCGCGCTGTGCGGCGCGGGCGAGGCGGGGGGCGGCGCGGGGGGCGGGCGGCTGCTGTCGCGCGACGTGTACTGTCGCGAGCGGCGCCTGCGGGACTGGGTCAACCTGCTGGACAACACGCCGCCGCACCACCCGCAGCGGGACCACCTCGACCTCACTCTGTAGAGACCGAGCGCGCCGCATTTATTTATTTTAATCGTAACATCAAATCGTTATATTGCGCAACCCGGGTCGTGTCAAATAAATACTTTACTAATAAAACATTTAAAAATAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 

ORF

 ATGGCTTTATACGAAGGGATAGCTCTAATACAAGAGAAACAAGCCGTTGTACTAGATTTGGGCAGTGAATATACCAAGTTTGGTTTTACTGGTGAAGCAGCTCCACGATGTATTATAAGATCACAATTCTGGTGCTCGACAGAAAGAAGATTCAAGAAGGTTTATGAGTACTCTACACCTGAGGAGCTATATGATAACCTAGTTAATATGTTACATTTATTGTATTTTAGGCATGTCCTGGTGAATCCAAAGGAACGTAAAGTGGTTGTAGTGGAGTCCCTGCTCACTCCTACTCTGTTCAGGGAAACACTAGCCAAAGTACTGTTCACACATTATGAGGTGTCTGGCGCGGTGTGGGCGGACAGTCCGCGGATGTGCGCGATGACGCTGGGCGCGCCTGTCACGCTGGTGGTGTCTCTGGGCGCCCGGGAGGCCGAGGTGGCCGCCGTGGTGCACTCGTGCGTGGTGCTGCGCGCCGTGCAGGCGCAGCCGCTGGGCGCCGCCGCCGTGCGCGCCGAGCTGCTGCACCTCCTGCGCCAGGACTGCGGCCCCGACCTGCACCTACCCGACCATGTGCTCGAGGACATCACAGTGAAGACGTGCTTCGTGAGCCCGCGGGCGCGCGCGCTGCGCTGGCAGTCGGACAGCCCGCCGGAGCCGGCGCGCAGCGTGCGCTACCCGCTGGCGCGGCTCGGCGCCGTGTGCGTGTCGGGGCGCGCGCGGGAGCTGGCCGCCGAGCCGCTGTTCCGGCGCGACAACGAGCTGGCCTCTCTCCCCGACATCGTGCTGCAGTGCATCATGCAGTGTCCGATCGACGTGCGGCGCGCGCTGGCGGCCAACGTGCTGCTGACGGGCGGCGCGGCGTCGCTGCCAGGGCTGCGCGCTCGCCTGTCCCAGGAGTTGGCGCACCTGTGCACGCTGCCGCCGTACAGCTCGCGGCTGCGGCTGGGCGAGTTCAAGTTCCACCGAGCGCCGGCGCACGACATGAGCTGCGCGTGGCTGGGCGGCGCGCTGTGCGGCGCGGGCGAGGCGGGGGGCGGCGCGGGGGGCGGGCGGCTGCTGTCGCGCGACGTGTACTGTCGCGAGCGGCGCCTGCGGGACTGGGTCAACCTGCTGGACAACACGCCGCCGCACCACCCGCAGCGGGACCACCTCGACCTCACTCTGTAG 

Protein

 MALYEGIALIQEKQAVVLDLGSEYTKFGFTGEAAPRCIIRSQFWCSTERRFKKVYEYSTPEELYDNLVNMLHLLYFRHVLVNPKERKVVVVESLLTPTLFRETLAKVLFTHYEVSGAVWADSPRMCAMTLGAPVTLVVSLGAREAEVAAVVHSCVVLRAVQAQPLGAAAVRAELLHLLRQDCGPDLHLPDHVLEDITVKTCFVSPRARALRWQSDSPPEPARSVRYPLARLGAVCVSGRARELAAEPLFRRDNELASLPDIVLQCIMQCPIDVRRALAANVLLTGGAASLPGLRARLSQELAHLCTLPPYSSRLRLGEFKFHRAPAHDMSCAWLGGALCGAGEAGGGAGGGRLLSRDVYCRERRLRDWVNLLDNTPPHHPQRDHLDLTL* 

Auto annotation result

Program/Analysis Accession Description Score/Expectation
Pfam/Hmmer3 PF00022.14 Actin
Pfam/Hmmer3 PF09485.5 CRISPR-associated protein Cse2 (CRISPR_cse2)
BLASTP/NCBI-nr EHJ75203 actin-related protein 10 [Danaus plexippus] 1e-162
InterPro IPR004000 Actin-like

Expression data (EST count)

Paralog/Ortholog genes

Paralogous genes

Gene ID Official gene ID Chr. Chr. start Chr. end Scaffold ID Start End Direction

Orthologous genes

Species Gene ID Scaffold ID Start End Direction
D. plexippus DPOGS209047 DPSCF300102 39545 42917 +
H. melpomene HMEL006086 HE670358 53917 63841 +
M. sexta Msex003871-RA scaffold00052 1277614 1290310 -
P. xylostella Px011496.1 scaffold_437 82610 92022 +